Reading Response to the Maltese Falcon

Spade and Archer accepted the job apparently because they felt the pay was good and that they could earn more if hey executed the job properly. However, event that unfolded immediately afterwards made it obvious that detective Spade had gotten himself into a serious criminal case. First was the death of his partner Miles Archer, then the allegation by Lieutenant Dandy and Tom Populous that Spade is a prime suspect in the murder of his partner.In his bald to find out what happened to his partner and to clear himself of allegations of murder. Detective Spade finds out the truth about Miss Wondered whose actual name was Brigit Gaucheness's and her connection to Floyd Thirsty who was not inning away with Bride's sister, but was her acquaintance who had betrayed her and perhaps had in his possession a prized Object -the Maltese Falcon. Eventually, Spade is able to obtain the Maltese Falcon and why it was so important.Also, Spade is able to discover the reasons for which his partner was mu rdered, as well as the party responsible for the murder crime which turned out to be Burgled Gaucheness's. The Maltese Falcon turned out to be and interesting read for me, the direct style and the fact that it was not too lengthy made it a bit easy to finish it within a short time. I discovered that Dashiest Hamlet himself was once worked as an operative for the famed Pinker National Detective Agency (Marling, n. D. ). This could explain his In passion for hard-boiled detective Fulton novels.There are several reasons why I find the Maltese Falcon an interesting novel, from the plot to the fundamental theme of greed and the characterization as well as the inclusion of the well rooted stereotypical classification of women as expected in a detective fiction novel or film. Starting with the plot, the Maltese Falcon as a hard-boiled detective fiction does not spotting In the expected fast paced setting. From the point when Miss Wondered walks Into Spade and Archer's office, It was a puls ating encounter for Spade hopping getting entangled in a complicated situation.Personally, I found it a bit difficult to drop the book as I wanted to get to the end of it as quickly as possible. In this regard, I think the novel could have used a little more suspense as it was somewhat straight forward with less ambiguity. Asides from this tiny complaint from me, it was a novel I enjoyed reading. Also, I personally feel the way and manner Hamlet throws introduces readers to the characters makes it easy to connect these characters with their actions. From the opening description of Samuel Spade, one could easily anticipate the kind of character he will be. He looked rather pleasantly like a blond Satan. â€Å"(Hamlet, 1929 up. 1) This description in my view depicts Spade as a someone possesses shrewdness and will normally put self-interest first when dealing with others. A stand out character foe me is the character of Brigit Gaucheness's, for her manipulative, femme fatal nature. T his is a major stereotypical characterization of omen in most detective fiction novel and it is still very much evident in today's novel and films.Her character portrays that of a woman who will stop at nothing to achieve her aim and will use what she considers her most potent weapon (her beauty) to get other to do or give her what she wants. The character of Sam Spade the protagonist of the novel, clearly depicts someone that is greedy and places self-interest and monetary gains over every other thing. When approached by Miss Wondered to help solve a problem, Spade despite knowing the client was lying accepted the task because of the financial gain he stands to gain. He made this clear when he stated â€Å"We didn't exactly believe your story.

Sample Pr Campaign

Communications Plan Addressing Most Pressing Reputational Issues Facing Livestrong Background of current issue facing Livestrong Foundation Lance Armstrong – the 7 time Tour De France winner, cancer survivor and founding chairman of the Livestrong Foundation, has been facing a lot of pressure and criticism from the media and the public due to allegations of doping made by the United States Anti Doping Agency (BBC, 2012). On October 17 2012 Armstrong resigned as Chairman due to allegation of doping (Mary, 2012).In November 2012, Lance Armstrong officially stepped down from the board of directors and ended his association with the Livestrong Foundation which was then known as The Lance Armstrong Foundation (Mclaggan, 2012; Vertuno, 2012). However, despite this, the opinion of the people towards the Livestrong Foundation is one of prejudice. Many companies who formally endorsed Armstrong have dropped him from their campaigns. Some of these companies were Nike, Trek Bicycles, Giro , FRS (energy products), and 24 Hours Fitness (Petchesky, 2012).Various reasons were given by the heads of these organizations as to why Armstrong was dropped. FRS Chief of Marketing commented: â€Å"this seems like a good time to part ways† while 24 Hours Fitness stated: â€Å"our business relationship with Armstrong no longer aligns with our company’s mission and values† (Schrotenboer, 2012). These and many more statements were made in regards to the doping allegations. Armstrong’s reputation and image is currently deteriorating rapidly.There are many opinions from segments of society (such as the public and the media,) regarding the Livestrong Foundation after this alleged scandal. Here is a brief overview of the situation from various stakeholders (See Appendix for Livestrong Foundation view): The Public: The public had varied opinions. There has been one section of people who have stood strongly by Lance Armstrong and the Livestrong Foundation. They stand by the fact that the foundation is still about researching a cure for cancer and so it will always be respected in the eyes of the community.Lou Hablas has supported Livestrong for years and worn the iconic yellow bracelet in honor of his uncle, stepmother and friends who have lost loved ones to cancer. The 49-year-old Georgia resident says he'll continue to wear the bracelet despite news that embattled cyclist Lance Armstrong is stepping down as chairman of the charity he founded 15 years ago. But the poster of Armstrong leading his Discovery teammates in the team time trial at the 2005 Tour de France is coming down from his office wall amid news that the U. S.Anti-Doping Agency found â€Å"overwhelming† evidence of Armstrong's involvement in doping as a professional cycler. â€Å"What Lance initiated through the formation of a foundation in his name and efforts through Livestrong far exceed this formal and seemingly final recognition of Lance's fallibility, Cancer su cks and it is much bigger than Lance Armstrong † Hablas said in an interview with CNN (CNN, 2012). The feeling of Lou Hablas mirrors the feeling of millions around the world. While they still continue to strongly support the Livestrong, their respect for Lance Armstrong has diminished due to the doping incident.They are able to separate the foundation from Lance Armstrong and the controversy surrounding Lance Armstrong does not change their opinion on the Livestrong Foundation. On the other hand, there has also been a large segment of the public who have lost their faith in the Livestrong Foundation. Wendy Adams of Manchester, Pennsylvania, and her sisters have been wearing their yellow bracelets since their father was diagnosed with end stage prostate cancer in 2004. When her father died in 2005, the family respected his wish to be cremated wearing the bracelet and spent $200 dollars on the bracelets for family and friends to hand out.Now, she says she can't wear the bracelet with pride anymore because of its connection to Armstrong and the organization. She has taken it off and vows to never again wear it. She says â€Å"Lance is Livestrong, he is the face of hope. And when that face is that of a liar, a manipulator, for me? I can't wear it with pride anymore. † (Ibid) Therefore we see that the public has different opinions regarding the Livestrong Foundation after Lance Armstrong’s doping scandal. But the vast majority of people are able to distinguish between the Livestrong Foundation and Lance Armstrong.They recognize that the Livestrong Foundation is about cancer which is much bigger than Lance Armstrong and the foundation needn’t suffer due to the Lance Armstrong scandal. The Media: The media has been investigating the Livestrong Foundation closely after the Lance Armstrong doping scandal. The Livestrong Foundation has been under intense scrutiny recently. Bill Gifford, a journalist from OUTSIDE magazine, released an article s tating that the Livestrong Foundation doesn’t in fact do much to fund research to find a cancer cure (Gifford 2012).He states in his article â€Å"Equally interesting is what the foundation doesn’t do. Most people—including nearly everybody I surveyed while reporting this story—assume that Livestrong funnels large amounts of money into cancer research. Nope. The foundation gave out a total of $20 million in research grants between 1998 and 2005, the year it began phasing out its support of hard science. A note on the foundation’s website informs visitors that, as of 2010, it no longer even accepts research proposals† (Ibid. ).Gifford also goes on to say that the primary goal of the Livestrong Foundation is to advertise and promote Lance Armstrong as he is the face of the foundation. He says â€Å"I found a curiously fuzzy mix of cancer-war goals like â€Å"survivorship† and â€Å"global awareness,† labels that seem to entail p lastering the yellow Livestrong logo on everything from T-shirts to medical conferences to soccer stadiums. Much of the foundation’s work ends up buffing the image of one Lance Edward Armstrong, which seems fair—after all, Livestrong wouldn’t exist without him.But Livestrong spends massively on advertising, PR, and â€Å"branding,† all of which helps preserve Armstrong’s marketability at a time when he’s under fire. † Such stakeholder viewpoints illustrate that Livestrong has to be careful in all its future endeavors as it is under constant scrutiny due to the doping allegations surrounding Lance Armstrong. This may have serious impacts related to the loss of Livestrong’s reputation and hence the challenge is in disassociating the Livestrong brand from its founder Lance Armstrong.The message must be communicated that Livestrong is about the fight against cancer at a global level, rather than a mere doping scandal by its founder. ————————————————- The key issues identified previously in this report highlight the importance of rebuilding Livestrong’s brand image in a manner that refocuses public attention towards Livestrong’s over-arching agenda and manifesto: To fight cancer with determination in the face of adversity.The following communications plan outlining key aims, objectives, strategies and tactics has been produced with this message at heart. The formal severing of ties with Lance Armstrong, are the first steps taken by the Livestrong Foundation towards this process. ————————————————- PHASE 1 Key Aims * Identify key stakeholders that are currently affected by the crisis, who it may affect and why. * Refocus public attention towards cancer victims and inspirational c ancer fighters supported by Livestrong. Ensure that communication is clear, compelling, continuous, consistent and sustained. * Ensure that engagement, understanding and commitment amongst internal stakeholders is achieved in relation to implementing strategies and tactics to overcome crisis. Promotional Channel: Public Relations Objective: Honest and sincere Acknowledgement of the problem Livestrong is facing, the action taken and highlighting the need to focus on the true adversary – cancer itself. Strategy: Communicate in totality to internal and external stakeholders within the next 6 months.Tactics: 1) Organising a press conference A spokesperson that holds a prominent role in the Livestrong Foundation will address the public. In preparation for the press conference, the spokesperson will be given full media training beforehand in responding to questions by the press such as: What is Livestrong’s current stance on doping? How does Livestrong plan to attract donati ons when its founding member can no longer inspire donors or call on celebrity contacts? Who will lead the organisation now that Armstrong has stepped down?What will be the next steps of the charity? etc. (More questions will be prepared for media training, closer towards the launch of the press conference). The Spokesperson will begin the conference by acknowledging the doping allegations made towards Livestrong’s former founder which have resulted in the foundation formally severing ties with Lance Armstrong. The spokesperson will then, make it explicit that it was a necessary decision made with the true cause at mind – Fighting Cancer, which at the moment is not receiving ull attention by the foundation and its public due to Armstrong’s doping allegations. The spokesperson will highlight the significant difference made by the Livestrong Foundation in its long-term fight against cancer through conducting educational programs emphasising on healthy lifestyle, a nti-stigma campaigns and Grassroots fundraising events; all done in order to raise awareness, increase outreach and facilitate collaboration in an effort to improve the situation of cancer patients.Furthermore, the spokesperson will highlight that it is important for the public to keep in mind these contributions made by Livestrong in the fight against cancer and will advise the public to ‘look at two separate people: Lance Armstrong the cycling champion allegedly turned drug-user and Lance Armstrong the cancer fighter and symbol of inspiration† of which the latter was the reason for Livestrong’s success until this point.Not only does Livestrong reach out to cancer patients, but also to those who look for inspiration, determination and hope, in their darkest hours of need. After these key points are made, the spokesperson will invite the press for a Q&A session. 2) Distributing press releases and feature articles online and offline Firstly, a number of press relea ses will be distributed to key media outlets (offline) and wired agencies (e. g. Reuters online), raising and addressing similar points to that of the press conference.Secondly, feature stories focusing on Livestrong Foundation support given to local and national cancer victims and their families will be distributed (both online and offline) in local and national media outlets. These stories will focus on an angle showing the determination of the cancer victims, survivors and their families and how Livestrong aids them in this journey through emotional and financial support; essentially, communicating in a compelling way to engage the public with Livestrong.Further, by distributing a considerable number of press releases and feature stories online, it would ensure that members of the public will encounter such stories which focus on Livestrong’s positive impact on society, in effect, proving to be a cost effective-method achieving search engine optimisation (SEO). 3) Social m edia engagement Firstly, a video release will be made (utilising YouTube) featuring the incoming board chairman of the foundation – Jeff Garvey, who outlines the next steps that will be taken by the Livestrong Foundation followed by the severing of ties with its former chairman – Lance Armstrong.This would mainly involve giving undivided attention towards the Livestrong Foundation mission in â€Å"providing free financial, practical and emotional support services for cancer survivors and their families. † This video will then be attached to Livestrong’s website, Facebook page, Twitter account and Blog. This will be followed by an invitation to the public to give their honest opinion about Livestrong and suggest ideas about what steps the foundation could take in order to better contribute to its fight against cancer.In addition, a competition will be posted on Facebook and Twitter announcing that the winner who suggests the most creative and engaging idea will have their name as part of the next Livestrong campaign title and the opportunity take part as one of the campaign team leaders. Not only will this type of approach promote symmetrical communication between Livestrong and the Public, but also indirectly suggests that Livestrong is trying its best to move past the Lance Armstrong doping scandal and refocus all its energy towards fighting cancer. ) Establishing an Intranet system for internal stakeholders of the Livestrong Foundation Given the possibility that not all members, employees and shareholders may be aware of the severity of the issue concerning Lance Armstrong’s alleged doping scandal and the strategic action taken to repair Livestrong’s reputation; an intranet will be established to provide the latest information on the issue and steps taken to rebuilding Livestrong’s brand image in a manner that refocuses public attention towards Livestrong’s battle against cancer.The intranet page will b e maintained by a trained team who will monitor current problems, predict any future revelations and watch the movements of public and media opinion closely. This will also provide the opportunity for internal stakeholders to ask questions, post responses, and contribute ideas about the crisis in a community sphere. Measurement and Evaluation Firstly, feedback could be gained from journalists, who will attend the press conference, on whether the responses given by the Livestrong Foundation were sufficient in communicating Livestrong’s future intentions and vision purely focused on battling cancer.The press releases and feature stories will be evaluated in relation to how consistent, clear and compelling they are in producing communication outcomes (e. g. Whether the key message was fully, partially, incorrectly, negative/positively, etc. conveyed . In relation to evaluating the level of public engagement with social media, they will be measured according to the tone of commun ication. For example, whether the blog, twitter and Facebook responses by the public, were positive, balanced, neutral or negative.Furthermore, this will also be measured by tracking levels of public engagement. E. g. whether target audiences are: Lurking, Casual, Active, Committed or Loyal. The activity on the intranet will be measured in a similar fashion although it would also include tracking the amount of internal stakeholder response within a period of 6 months. Given that the above strategies and tactics are successful and meet the objective, the Livestrong Foundation can move towards the 2nd phase which involves creatively utilising the promotional channels of Advertising and Viral Marketing.Note: The above strategies were considered after examining the cases of Sony and Dell when they faced a product defect issue where they avoided damages to their reputation through responses received through their established crisis website (Larkin and Register, 2008:63) Further, the case concerning the rebranding of Scope – the charity organisation for cerebral palsy – was also examined in detail (Scope, 2012). ————————————————- ————————————————- PHASE 2 Promotional Channel : AdvertisingObjective: Ensure a new and improved understanding of Livestrong by the public. Strategy: Creating a new advertisement to broadcast Livestrong’s new image. Tactics: Two different advertisements will be made for two groups of audiences. 1. Advertisement directed towards the general public: This advertisement features a little girl frolicking happily in a garden. The whole frame is colourful. Suddenly, a monster called â€Å"cancer† appears, and a thunder storm occurs. The little girl begins to cry in fear. At this time, a large number o f Livestrong wristbands appear to fight the monster and protect the little girl.The wristbands knock the monster down and sunshine prevails. The slogan: Let Livestrong Protect the One You Love then appears . The advertisement will be shot in the style of caricature which makes it simple and easy to comprehend. Even children will be able to understand the advertisement; therefore, the target audience is broadened. This inspiration comes from Fresh Start—the campaign which is called up by Welsh government to stop smoking in cars. This campaign used children as their starting points and inspired people stopping smoking. ((2012). GOLLEY SLATER LAUNCHES FRESH START WALES. Online] Last accessed December 13th). 2. Advertisement directed towards cancer survivors and their families The second advertisement is aimed at encouraging people who have suffered from cancer to be hopeful and to trust Livestrong. This advertisement will focus on the reliability of the Livestrong foundation. Th e advertisement has a black and white tone to portray people’s emotion after knowing that they get cancer. This scene will simply focus on the facial shots of people who have just found out that they have cancer. Sad music plays in the background to enhance the affect.After this, the Livestrong wristbands appear. The yellow color of the wristband symbolizes sunshine and how Livestrong can brighten the lives of those who suffer from this terrible disease. The advertisement ends with the frame being full of sunshine and smiles on the faces of the people who suffer from cancer. Platform: These advertisements will be played in public places, such as subway stations and bus stops because it has a wider reach in terms of viewers. Some posters with a similar theme will also be used as outdoor advertisements. There will also be a donation box near the screen.This is done because people will feel the need to donate immediately after viewing such a touching advertisement. Prediction: I t is estimated that 6 months into the advertising campaign, the awareness of Livestrong will increase by 30%. Also, the donation towards the Livestrong foundation will also increase about 10%. Promotional Channel : Viral Marketing Objective: Increase people’s awareness of Livestrong Strategy: Take advantage of social media, such as Youtube, Twitter and Facebook to let more people know Livestrong’s new image Tactics: 1. Flash MobThere will be several â€Å"flash mob† activities in target cities, such as London and Manchester, which means organizing about 50 people at the city landmark wearing Livestrong apparel and repeat the Livestrong’s slogan. All this will be recorded and broadcasted onto social media sites. This tactic is inspired by the popularity of Psy’s Gangnam Style. Gangnam Style’s shoot to popularity is attributed to the effective use of social media through which it gained global recognition. 2. Twitter and Livestrong Another act ivity, mainly to do with Twitter, can also be undertaken.A custom designed poster stating â€Å"Keep Calm and Trust Livestrong† will be posted by Livestrong. Every time the poster is re-tweeted, Livestrong will donate 1 pound towards a cancer rehabilitation center. This action will not only help people who suffer from cancer, but will also pique the attention and interest of the people and increase brand awareness. Platform: Social media will be the main platform for this strategy as it is currently more popular than traditional means of marketing. Social media will reach a very wide range of audience†¦ from the youth to the older generation.Also, the broadcasting speed of social media is faster compared to broadcasting via traditional means. ————————————————- Prediction: In this six months campaign, Livestrong’s exposure rate on social media will increa se and people will have more positive aspects to discuss about Livestrong. ————————————————- Word Count: 3,275 References British Broadcasting Corporation (BBC). (2012), â€Å"Lance Armstrong receives US Anti-Doping Agency charges. ’ [Online] Available at: http://www. bbc. co. uk/sport/0/cycling/18435771 [Accessed: 1 December 2012].Burleigh, N. (2012), ‘Will Livestrong Stay Strong? ’ [Online] Available at: http://www. bicycling. com/news/featured-stories/will-livestrong-stay-strong? page=0,1 [Accessed: 1 December 2012] CNN (2012) ‘Livestrong bracelet: To wear or not to wear?. ’ [Online]. Available at: http://www. cnn. co. uk/2012/10/18/living/lance-armstrong-livestrong-legacy/index. html [Accessed: 1 December 2012] Gifford, B. (2012), ‘It's not about the lab rats. ’ [Online]. Available at: http://www. outsideonline. com/outdoo r-adventure/athletes/lance-armstrong/Its-Not-About-the-Lab-Rats. tml? page=all [Accessed: 1 December 2012]. Golly Slater (2012), ‘Golly Slater launches Fresh Start Wales. ’ [Online]. Available at: http://www. golleyslater. co. uk/services/public-relations/news/news-detail. php? id=976 [Accessed 29 November 2012] Livestrong (2012) Livestrong Milestones [Online]. Available at: http://www. livestrong. org/Who-We-Are/Our-History/Milestones [Accessed: 10 December 2012]. Maclaggan, C. (2012) ‘Exclusive: Livestrong cancer charity drops Lance Armstrong name from title’ [Online]. Available at: http://www. chicagotribune. om/sports/olympics/sns-rt-us-cycling-armstrong-livestrongbre8ae000-20121114,0,6273785. story [Accessed: 1 December 2012]. Mary, P. (2012) ‘Armstrong Is Dropped by Nike and Steps Down as Foundation Chairman. ’ [Online]. Available at: http://www. nytimes. com/2012/10/18/sports/cycling/lance-armstrong-dropped-by-nike-steps-down-as-chairman -of-his-charity. html? pagewanted=all [Accessed: 1 December 2012]. New York Times (2012) ‘Times Topic: Lance Armstrong. ’ [Online]. Available at: http://topics. nytimes. com/top/reference/timestopics/people/a/lance_armstrong/index. tml [Accessed: 1 December 2012]. Petchsky, B. (2012), ‘A full list of the brave brave companies that dropped lance Armstrong only after Nike did. ’ [Online] Available at: http://deadspin. com/5952679/a-full-list-of-the-brave-brave-companies-that-dropped-lance-armstrong-as-an-endorser-only-after-nike-did. [Accessed: 1 December 12]. Regester, M. & Larkin, J. , (2008) Risk Issues and Crisis Management in Public Relations: A Casebook of Best Practice. London: Kogan Page. Schrotenboer, B. (2012), ‘Livestrong: Only 8 donors asked for their money back. ’ [Online]. Available at: http://www. usatoday. om/story/sports/cycling/2012/11/12/livestrong-lance-arms trong-doping/1700831/ [Accessed: 1 December 2012]. Scope (2012), â₠¬ËœThe Spastics Society to Scope: The story of the name change and relaunch November in 1994. ’ [Online] Available at: http://www. scope. org. uk/sites/default/files/pdfs/History/Scope_name_change. pdf [Accessed: 1 December 2012]. Vertuno, J. (2012) ‘Lance Armstrong Cuts Formal Ties to Livestrong, Resigns from Board’ [Online]. Available at: http://www. therepublic. com/view/story/c98e415cc01346f19a7a67a12ead195f/CYC–Armstrong-Livestrong [Accessed:1 December 2012].Wall Street Journal (2012) Statement by Lance Armstrong [Online]. Available at: http://online. wsj. com/article/SB10001424052702303734204577464962634804348. html [Accessed: 1 December 2012]. APPENDIX The Livestrong Foundation Perspective of Lance Armstron’s Allegations: The Livestrong Foundation was initially very supportive of Lance Armstrong during the doping incident. However, Lance Armstrong stepped down from the board of directors of the foundation and ended all association with Livest rong. This was done to ensure that the negative publicity directed towards Lance Armstrong would not affect Livestrong’s popularity.The incoming board chairman, Jeff Garvey, said that Armstrong was distancing himself from Livestrong to protect it against any damage resulting from his doping controversy. â€Å"Lance Armstrong was instrumental in changing the way the world views people affected by cancer,† Garvey said. â€Å"His devotion to serving survivors is unparalleled and for 15 years, he committed himself to that cause with all his heart. † (The New York Times 2012). Livestrong CEO Doug Ulman, a cancer survivor himself, sees the scandal as little more than a sad distraction from a noble cause, and he sees no need for a formal distancing from Armstrong. This organization has never been stronger in terms of fulfilling our mission and the support that we receive from literally millions of people,† he says. â€Å"We are trying to tackle a global problem, the number one cause of death around the world. And so the investigation unfortunately has become a distraction from our mission. We are literally, positively changing lives every day and we have so much more to do and to be pulled away and distracted even for 10 minutes is

David Foster Wallace Essay

In this essay I am going to do my best to give the reader the most informative explanation (within my constraints) of one of the most brilliant authors of the age, David Foster Wallace. He was the author of many great and insightful (at times, dark) works. Some of the more popular/well-known pieces being _The Broom of the System, Girl with Curious Hair, Infinite Jest, A Supposedly Fun Thing I’ll Never Do Again, Brief Interviews with Hideous Men, Oblivion_, and finally his incomplete novel, _The Pale King_. In all honesty, to even scratch the surface of an individual with this amount of depth would require a work similar in size and time to his â€Å"tree-killer† of a novel, _Infinite Jest_. That being said, I hold the belief that every free-thinking individual should at least know-this man’s name in hopes that it may show them the way to his works on what it means to be â€Å"a fucking human being†. Read more: Good people summary essay David Foster Wallace was born on 21 February 1962 and finally met his end 12 September 2008 at the age of 46. Wallace was born in Ithaca, New York, to his parents, James Wallace and Sally Foster. His father, a previous graduate student in philosophy at Cornell, was from a family of professionals. His mother, on the other hand, was an English major at Mount Holyoke College in Massachusetts, with a more rural background with family residing in Maine and New Brunswick. She was also the first in her family to acquire a Bachelor’s Degree. At the age of 4, David moved with his family to Champaign-Urbana, Illinois for a better job opportunity. His home life was very structured (dinner at 5:45 p.m. and lights out at precisely 8:30 p.m.) and was very conducive for intellectual growth. It was a happy home. As he gets older, Wallace starts to realize many things. First, he had a love for tennis. With his logical and calculating mind, he could easily see the geometrical angles the ball could make as it bounced off the racket, leading him to become one of the top players in his region at that time. Other things start to surface as well; sadly, these were not among some of the happier things. He started to analyze his physical and mental self, picking at each and every flaw (compared it to sort of â€Å"counting sheep†), which did nothing to alleviate his problem at being socially awkward. He eventually  found his first love, Susan Perkins, who, at the time, already had a boyfriend. It’s also important to note that this was the point when Wallace discovered the joys of smoking pot. After high school, Wallace planned to attend Amherst. He chose Amherst mostly because it meant he wouldn’t have to go to another interview. His father was an alumni, so he was pretty much a shoo-in. By his sophomore year, he was developing a reputation for his intelligence. He was earning straight A’s and was actually opening up and making friends, until he returned from Christmas break at home. He was an entirely different person when the depression took him, as his college roommates described. After a few weeks of trying to tough it out, Wallace realized he was going to have to withdraw and go home. Something was clearly wrong. He returned in Fall 1984 for his senior year. Eventually, Wallace graduated and was awarded double summas for his two honors theses. _The Broom of the System_ would eventually be published and become his first serious fiction novel. This was the point when Wallace discovered his love of writing fiction. As an immature â€Å"adult† in an adult world, Wallace made the decision to start teaching to supplement his writing career and gain health insurance for his special needs. His first teaching job was at Emerson College in Boston, Massachusetts. He hated teaching. For him, he was just wasting time with kids who didn’t even want to do their homework; when he could be spending valuable time on his career as a fiction author. Up to this point, Wallace has steadily been falling deeper and deeper in to his addictions. He had been smoking pot, cigarettes, and drinking almost every night as a way to cope with the depression that can so cripple who he is as a person. As his frustration with his inability to write worsens, so does his addiction. With his frustration and addiction worsening, Wallace again breaks down and must be hospitalized. The medical professionals said he must find a different path, or he would be dead by thirty. Wallace begins rehab, and for months, will live in nothing but rehabilitation centers and halfway homes. As part of these programs, he must attend 12-step AA meetings for recovery. These really hit home for Wallace; they work for him in ways he would never have thought possible. The meetings he would attend ended up becoming major plot  points in the greatest novel he ever wrote. Shortly after getting out of rehab, Wallace started working on his novel again, this time with renewed vigor. In a letter to his editor, he said he was going to â€Å"finish it or die.† Upon finishing the monster novel and the following editing, summarizing, and shortening pains, the greatest achievement in his literary career thus far was finished; 1079 pages, water-tight and ready for publishing. What followed were multiple interviews and readings, which Wallace had been signed up for in order to gain publicity and sell more books. All of which, Wallace summed up as â€Å"whorish.† He wasn’t even sure most of the people coming had even read his book. With fame comes pleasure†¦ of a sort. The more famous he became, the more women seemed to flock to him. Considering how badly his relationships had been going, one night stands were just what he thought he needed. To put it another way, he was really bad about taking the â€Å"13th step† (getting involved with a fellow recovery partner). These relationships would start out normal, maybe a little obsessive, but as time went on they would turn into violent and controlling relationships. Many of them ended terribly, which turned out to one good thing. He had found new companions. Dogs. He adopted a lab and called him Jeeves, and later adopted a stray whom he would later name The Drone. Once his fame started to settle, he no longer had book tours or things of that nature anymore. Now magazines and newspapers were going after him with nonfictions they wanted him to review, and he ended up making short stories out of them. For the most part though, these were just distractions from his real objective, â€Å"The long thing.† While he continued his progress on this novel, he was switching jobs and found a new and seemingly real relationship with a lovely woman named Karen. They would grow close over time, completing one another until they were finally married on 27 December 2004. Wallace would continue his work on â⠂¬Å"the long thing† until the day he died, never really bringing it to the point where he was satisfied with it. David Foster Wallace’s major works include _The Broom of the System, Girl with Curious Hair, Infinite Jest, A Supposedly Fun Thing I’ll Never Do Again, Brief Interviews with Hideous Men, Oblivion_, and finally his incomplete novel, _The Pale King_. During these later years of his life, he was a writing professor at the Pomona College in Claremont, California. The  publications he worked on in his spare time numbered all of one. â€Å"The long thing† (The Pale King) had been his project for many years, and he could not see how to turn the idea of boredom in the story in to something intriguing. David Foster Wallace died 12 September 2008 in Claremont, California. His wife arrived home at 9:30pm, after a stint at her art show, to find that her husband had hanged himself with a garden hose on the patio. After a 20 year battle with severe depression, Wallace could no longer endure. To him, the unbearable and unending pain of his depression could only be cured by death’s sweet release. Upon announcement of this tragedy, various colleges held gatherings in remembrance of one of the most influential figures in literary history, giving the friends and family who attended, a chance to grieve and say goodbye. Karen keeps his ashes in a foil-wrapped box next to a picture of both of their mothers. _Infinite Jest_ was published 1 February 1996 by Little, Brown. It was well-received with minimal, negative reviews. It depicts our culture in the truest sense, and the fact that, beyond all the noise and false happiness, something real exists. Even though this book was released more than a decade ago, the steady continuing sales is a tribute to its realism and mesmerizing intrigue. When most of his major works were published, they weren’t really understood, and, to some degree, they still aren’t. Most of the understanding of his works was left to people of a similar caliber, and everyone else left by the wayside. I believe the works of David Foster Wallace should be standard for college education. As far as high school, to really grasp the man and his work, a student must delve into the realities of his life that, at times, can be surreal, even inappropriately grotesque. Hence, I believe his work is better suited for a mature audience. In conclusion, David Foster Wallace’s Infinite Jest is one of the most profound books in recent history, one that every man and woman should read in their lifetime. (should probably read it twice) David Foster Wallace, was a broken, yet brilliant man who left this life with profound hope in his  works that we could learn to be human beings, with actual feelings and actual thoughts beyond the abyss that is our oppressive culture. Works Cited â€Å"Brief Interview with a Five Draft Man†. _Amherst Magazine_. Amherst College, 1999. Web. 13 April 2014. Max, D.T.. _Every Love Story is a Ghost Story_. New York. Penguin Group, 2012. Print. Max, D.T.. â€Å"The Unfinished†. _The New Yorker_. Conde Nast, 9 March 2009. Web.14 April 2014. McInerney, Jay. â€Å"Infinite Jest†._The New York Times_. The New York Times Company,3 March 1996.Wen.13 April 2014. Silverman, Jacob. â€Å"The artful mediation of Karen Green, David Foster Wallace’s widow†. _Los Angeles Times_. Los Angeles Times, 31 May 2013. Web. 14 April 2014. Weber, Bruce. â€Å"David Foster Wallace, Influential Writer Dies 46†. _The New York Times_. The New York Times Company, 14 September 2008. Web. 13 April 2014.

Historical Challenges of Urban Planning Essay Example | Topics and Well Written Essays - 500 words

Historical Challenges of Urban Planning - Essay Example Modern urbanization mostly entails improvisation of the early urban cities. Planning an urban centre is influenced by certain factors such as historic preservations, strategic plans, regulatory and incentive strategies, comprehensive plans, or even neighborhood plans (Levy, 2011). Therefore, a planner ensures enforcement of the chosen policy in urban planning. Urban planning can be viewed as a complex and sequential procedure that considers the welfare of the population around. This paper discusses in length challenges that were faced by historical urban planners and they were able to overcome and can pose as an example to the upcoming urban planners. As depicted by scholars, history in one way or the other repeats itself, is evident in the society. Urban planning is a process that used to be centuries ago and still ongoing due to changes in technology. Planning an urban centre is not an easy task and is accompanied by several challenges. Urban planning involves the social-economic aspects in a city contrary to historical planning that dealt with improvisation of physical aspects of streets and buildings (Balducci, 2011). Although these two types of planning systems differ, there are several challenges that were faced by historical planners that other planners can learn from. One of the challenges that faced most of the historical urban planners was infrastructure and public health.

Art Scavenger Hunt-Analysis Essay Example | Topics and Well Written Essays - 1250 words

Art Scavenger Hunt-Analysis - Essay Example They made these paintings either by blowing the natural pigments from their mouth on a variety of objects or by using brushes made by chewing twigs (Buehler 56). On the basis of whatever information that can be solicited from the contemporary Australian aboriginal people and can be drawn from the research undertaken by the historians and anthropologists, it would be quiet true to say that the painting under consideration and many of the other aboriginal rock paintings like it were primarily made to fulfill some important spiritual and religious purpose in the ancient aboriginal societies (Buehler 57). These paintings were not merely works of art but also carried ample spiritual and religious significance. The contemporary aborigines consider these paintings to be sacred and an integral part of their spiritual and cultural heritage. In the ancient aboriginal societies, these paintings served a distinct spiritual and religious function and purpose. The ancient aboriginal rock art to which the above given painting is affiliated to had some vital and important ritualistic purpose in the aboriginal societies (Buehler 58). This painting and the ot her rock paintings like it included within their ambit varied levels of associated with the aboriginal spirituality. Perhaps, just as it is in the later day art galleries, the aborigines drew these paintings on the cave rocks to protect them from the ravages of time, so as to pass them safely to the future generations. The particular rock painting is a worthy example of the prehistoric aboriginal art and depicts apt usage of the principle and elements of design. This rock painting is well balanced in the sense that the artist has used a somewhat leaner figure placed at the edge of the rock surface to balance albeit rotund figure placed at the centre. The painting is evidently that of a couple and the artist has specifically introduced variation in the delineation of two figures in the

Goals and Objectives of the Department of Homeland Security Essay

Goals and Objectives of the Department of Homeland Security - Essay Example The department is lead by Secretary Jeh Johnson who was given the leadership position during the period of 2013 and is recognized as the fourth individual to hold the position (Design, 2014). He has profound amount of experience in providing services in relation to securing the nation and enforcing the laws as well as practicing as a private attorney. He had previously held key positions to defend the nations. He was even employed as the Air Force department’s general counsel as well as assistant to the attorney of US for the southern district of the region of New York. There are seven assistant secretaries for the department including the assistant secretary of policy, foreign affairs, strategic management, and private sector. The main secretary is Alan Bersin who has been employed as an acting secretary for the office of policy making (Design, 2014). There are a total of 17 different directorates, offices as well as agencies that are a portion of the DHS. These include UCIS which serves the purpose of assisting those who want to migrate to the United States (Dhs.gov, 2014). CBP was created with the purpose of ensuring that terrorist as well as their warheads remained outside the soil of the United States. USCG was created to ensure the protection of the maritime region and practices of the United States (Dhs.gov, 2014). FEMA was created with the purpose of helping in improving the ability of the nation from protecting itself from any form of hazard. FLETC was created to train and develop the professionals of the law enforcement arena. ICE was created to ensure that the laws and regulations of the nations that were created regarding the border were being followed (Dhs.gov, 2014).

Recruiting,retaining and developing staff Essay Example | Topics and Well Written Essays - 750 words

Recruiting,retaining and developing staff - Essay Example Some of the processes considered during recruitments are planning, strategy development, searching, screening, and evaluation. Research shows that strategies are more important for any company that needs to recruit or attract employees. Such strategies address the immediate and long term needs of finding potential employees (Kumar & Sharma 550). An organization uses various methods during the recruitment process. Such methods have effects on the selection process and the efficiency of selection in a number of ways; first, methods used determines the number of applicants, more so qualified applicants that can be recruited for certain positions. Secondly, it determines the organization’s process of meeting its obligations to hire minority groups. This is done by advertising, sending information to minority colleges, and searching for qualified minority women. Thirdly, effects on the turnover rates of employees is inevitable, the facts is that lower turnover rates is evaluated because recruiters shows the positive and negative aspects of certain jobs. For example, in most cases the recruiters provides unrealistic expectations to the applicants about the company and jobs. Applicants are likely to be frustrated, dissatisfied, or leave a job at early stages. To avoid such actions, a company should provide a clear picture o f a company’s working, and training process (Kumar & Sharma 551). The recruitment process is done through two different sources; internal sources and the external sources. The internal source of recruitment is done by promoting workers in the lower level of job to the higher level. In most cases, the employees in the lower level are trained by the organization to have enough qualification for higher level. Research shows that, an internal source of recruitment is good for an organization because low cost of training is realized (Kumar & Sharma 551). External sources of recruitment are done to fill the vacancies at the lower level

Human Resource Management Essay Example | Topics and Well Written Essays - 2000 words - 26

Human Resource Management - Essay Example This was because in my sociology studies I had learned that culture was something that occurred naturally and not necessarily a HRM practice. In reality, I did not think that organizational culture had anything to do with the success or failure of an organization and to me the insistence on culture was overrated. People from diverse cultures might understand the same situation in various ways. Productivity may rise in a multicultural work environment as each employee brings diverse talents and skills that can be used to solve challenges. One thing that I did not understand was how these differences could bring about conflict in the work place (Schizas, 2009). In order to understand exactly how culture is crucial to the success of an organization, I studied IBM. IBM is a multinational corporation that has over 400,000 employees and in various parts of the world. My major reason for choosing IBM is because the company has a big presence in Asia and this means that the business practices that are applied in the United States are not likely to be applicable in Asia or Africa and this call for a change in the organizational culture. My main reason for undertaking this study is to find out exactly if organizational culture is important to the organization in trying to achieve its financial goals. To achieve my objective, I will look at the existing literature on organizational culture and how it affects businesses. I will however pay close attention to IBM especially on the changes that they have made in their organizational culture with a view to establishing if this has borne any fruits or not. Along the way, I will also be looking at some of the changes that the company has undertaken in order to realign its HR practices and strategies to enable it to move away from its traditional methods and to adopt new approaches. In the research, I will also seek to establish some of the common errors that are

Counseling Essay Example | Topics and Well Written Essays - 750 words

Counseling - Essay Example Life has become so complex and difficult, many things affect our lives in drastic ways and in the recent past we have witnessed terrorizing events, which have changed our lives forever. Everybody needs help in coping with such events and bringing their lives back to normal. We can identify a troubled individual by some signs such as poor performance, excessive absences or tardiness, irritability, substance abuse, hyperactivity or isolated behavior and many others. These signs are not to be taken lightly; we should take action when we notice such signs in an individual, basically have a plan of action. Talk to the individual and ask him if he needs help, usually the troubled individual would not admit that he needs help but still refer him to a counselor. (Colorado State University Police Department) Comforting the troubled is not an easy job and requires a support group of people who can understand your situation and relate to it. These days we have such support groups that are open to all, here people with similar experiences share their stories and provide each other with comfort. During such troubled times it is welcoming to be surrounded by people and knowing that you at least have somebody to talk to. If we think about it in a religious manner than to comfort the troubled is a good thing, we all want to comfort our loved ones whether it is a friend or a family member. If you are a Christian, the Church provides you with a lot of support and advice. If takes your mind off the troubled event and diverts you to the path of God. In the olden days counseling was only done by the religious heads but today, we have professional who are experts in this field. Their job is to listen to you and provide you with options, which can help solve the problem. These people are called counselors. They are paid to listen to you. Apart from going to a counselor, it is always helpful to have a close tightly knit group of friends and family members, these people can help get over the troubled thoughts more quickly and easily. Troubling the comfortable is totally opposite to comforting the troubled. This literally means to irritate and confuse people who are content with their lives and do not have any worries that according to them may be serious. Many people in our world have no concern for other people and although they live their life without interfering in other, they should show a concern for other people and their requirements. This feeling should exist among all human beings as part of humanity. We live our lives with everything we wish for, while there are millions who cannot afford one meal. In this sense they are the comfortable and they need to be troubled by asking them to help the people who cannot afford one meal or to feed their children so that they sleep on a full stomach. Counseling for this part of statement, troubling the comfortable is to make people aware of these situations and get them to express their humanity; to get people to perform good acts for the benefit of mankind. Bibliography 1. Dealing with Troubled People, Colorado State University Police Department, http://publicsafety.colostate.edu/Disruptive%20Behavior.pdf 2. What Is Counseling The Counseling Center,

Virtue Ethics Essay Example for Free

Virtue Ethics Essay Virtue ethics is grounded in â€Å"character traits†. We all have by nature the potential to be moral persons, but we need to practice the virtues, to cultivate them. Ex. a medical doctor should cultivate virtues such as: compassion, discernment, trustworthiness, integrity, benevolence and non-malevolence Kinds of virtues: 1) intellectual (wisdom, understanding etc) 2) moral (temperance, patience, courage etc) An individual is moral not because of his/her intellectual activities, but because of his/her feelings and actions. We need to practice virtues – ex. people become generous by giving We must decide: what is the â€Å"golden mean† from our individual perspective (ex. coward – courageous – hero)? The virtuous person must enjoy being virtuous (ex. not like the one who avoids stealing because of fear of punishment). Thus, virtue becomes its own reward. It must be performed for itself. Virtue ethics focuses on the type of person we ought to be, not on specific actions that should be taken. It is grounded in good character, motives, and core values. The possessor of good character is and acts moral. Virtue Ethics and Stakeholder Analysis Deontology is based on rules Utilitarianism is based on consequences Virtue ethics is based on character and motives It examines the motives and character of stakeholders – to see: what are the motivations of their strategies, actions, and outcomes? Regarding the corporate scandals: virtue ethics explains the motives of some CEOs actions – their greed, extravagant habits, irrational thinking, and egotistical character traits Difficulties a virtuous person may occasionally act horrible character traits change; if we don’t practice them, we loose them it emphasizes long-term characteristics – but this has the risk of overlooking particular lies or acts of selfishness on the grounds that such acts are temporary aberrations

Diversified in industries and electronics

Diversified in industries and electronics Introduction Initially, Samsung started out as a small export business in Korea. It then diversified in industries and electronics. The company has been responsive to change and opportunity in global business brought by the digital era with its constant innovation and attractive, marketable products.1 As a result, Samsung is now positioned as one of the world recognized leaders in the digital technology industry. The Samsung World Headquarters is located in Seoul, Korean. 1 History In 1938, founding chairman Byung-Chull Lee started a small trade export business in Taegu, Korea. In the 1970s, Samsung invested in the heavy, chemical and petrochemical industries as a foundation for future growth. Samsung also incorporated its manufacturing processes from raw materials to end products which further enhance its position in the worlds textile industry. Samsungs core technology businesses diversified and expanded globally during the late 1970s and early 1980s. Soon after, two research and development (RD) institutes were created. This boost its reach even further into electronics, semiconductors, high polymer chemicals, genetic engineering, optical telecommunications, aerospace and new fields of technology innovation from nanotechnology to advanced network architectures. In the mid-1990s, Samsung revolutionised its business aiming to make world-class products, provide total customer satisfaction and be a good corporate citizen. Samsung has constantly developed advance d technologies, competitive products and constant innovation 1. Main Technologies and Capabilities Main Capabilities Research and Development Innovation is at the heart Samsungs business success. To be competitive in the new digital age, Samsung maintains and strengthens its market dominance through the speedy introduction of new technology. The company has placed high importance to the interplay of creative, imaginative human resources, a global RD network, a strong collaboration among business partners all along the supply chain, and the commitment to ongoing investment. Currently, Samsung is making historic advances in RD of semiconductor products, especially flash memory and non-memory, custom semiconductors, DRAM and SRAM, LCDs, mobile phones, and digital appliances1 Eco Samsung Samsung has displayed its strong commitment and responsibility for the world environment. It has made efforts to develop environmentally-friendly products which consume low levels of energy and which contain no hazardous materials. The company has also modified its assembly processes to cut down carbon emissions substantially.2 Main Technologies Samsung comprises of companies that have become market leaders in a wide range of business, from electronics to financial services, from chemicals and heavy industries to trade and services. All the businesses are setting new standards in innovation, constantly generating high quality products and services.3 Owing to Samsungs large RD sector, many new technologies and innovative designs emerge. Below are a few of the newest technologies developed by Samsung. Main Markets, Products and Competitors Markets Samsung Group consists of numerous international affiliated businesses such as Samsung Electronics, Samsung Heavy Industries, and Samsung CT. These three multinational core businesses of Samsung Group signify their strong foothold in the electronics, shipbuilding and construction markets. Besides that, Samsung also plays a part in the financial, chemical, retail and entertainment markets. 1 Samsung reports a strong presence in its home country of South Korea as its market share in telecommunications is 18.87%. 1 Samsung appeals to the global market as it is the most popular consumer electronics brand since 2005 with 7.55% of global market share in telecommunications1. Products Samsung first started moving into businesses such as insurance, securities and retail. Later, upon borrowed foreign investments, Samsung ventured into the telecommunications industry with Samsung Electronics. With the support of South Korean President; Samsung developed the first dynamic random access memory chip. 1Most importantly Samsung are leading in the production of memory chips, chipmakers and liquid-crystal display panels. 1 Considered as a strong competitor in the world of electronics, Samsung highlighted innovative strategy and expanded production rapidly to become the worlds largest producers of DRAM chips, flash memory, optical storage and recently liquid crystal displays. In addition Samsung strives to improve by delivering innovative products such as the TV and monitor industrys thinnest LED TVs and most compact colour laser printers and multifunctional devices. Being a global leader in telecommunications equipment; Samsung plays the role in development of the next gene ration of 4G-network. 1 Competitors According to the Figure 1 below; Nokia is clearly the main competitor as it holds 37% of the mobile phones sales global market share. In 2009, Samsungs touch screen devices, QWERTY phones and smart phones drove sales in mature markets with 19% of the global market share7. LG poses 11% as a competitor as it moves into lower-tier devices which drive growth in emerging markets. It is also well positioned to take advantage of Chinas 3G Rollout as it can deliver good-value-for-money devices. Motorola has 11% market share which is reasonably smaller, however with its presence rapidly concentrated on the American it serves as a competition in the American market. Being in a competitive market, Sony Ericsson at 5% of the global market share attributes its poor performance to its uncompetitive range of handsets such as exploiting trends like QWERTY products. Therefore Sony Ericsson is a smaller competitor compare to Nokia and other phones such as Apple, HTC, and Blackberry. Nokia is Samsungs biggest competitor due to its early investments in GSM technologies therefore making the company into the worlds largest mobile producer manufacture. Up to date Nokia produced various innovative products such as the first 3G phones, Ovi internet services and N-series multimedia phone. Nokias revenue is reported to be 9.3 million Euros. 9 Its success is due to its high investment in the RD which is present in 16 countries, representing 31% of their total workforce. 8 Nokia phones are also seen as being highest quality as they have a highly recognizable packaging style which operates with an aggressive marketing strategy hence elevating them above their competitors. Samsungs Innovative Activities Samsungs ambition to become one of the worlds top companies is supported by continuous pursuit in innovative RD and building a distinctive brand. As stated in the Annual Report 2008, approximately 40 %( 42,100 researchers) of Samsungs global employees are involved in RD to develop cutting edge technologies1. Samsung Advanced Institute in Technology is the global hub of Samsungs RD organization which includes Mechatronics and Manufacturing Technology Centre and 14 overseas centres7. In 2008, Samsung obtained 3,515 patents in the US with an increase from 2007 placing them in second place in the annual patent ranking. To further push forward in a variety of market and customer focused brand marketing programs, Samsung successfully completed their role as the official wireless equipment partner of the 2008 Beijing Olympics and Paralympics Games. 7 In 2008, Samsungs investment of 6.9 trillion KRW which represented 9.5% of parent company sales brings in technological breakthrough such as 256GB solid-state drive, 90nm high-performance smart card chip, 82-inch 120Hz quad-HD-resolution TV panel, and a Mobile WiMax II (802.61m) solution.1 This also enables innovations like front-load washers with time, energy and wear-saving â€Å"bubble wash† technology and the industrys most compact colour laser printers. Following these success, Samsung plans to invest 7.9 trillion KRW in RD to support future development of tomorrows technology. 7 RD Structure and Priorities Table 2: Core business research areas at SAIT10 Research in Product Areas Descriptions Computer Science Drives long term differentiation of Samsung platforms(phones, TV) by combining Computer Science with Consumer Electronics Research involves building tangible artifacts like prototypes so that we can learn from the process of building them Current research: situation awareness, Intelligent Web Media and trusted platforms Situation awareness develops novel, optimal personalized services leading the next generation of personalized mobile technology Intelligent Web Media pioneers technologies such as new phenomenon in which all TV content is available on the Internet can be streamed or dowloaded directly to the TV Trusted platforms researches on strong protection of device firmware for network providers and users Wireless Connectivity Research in developing a wide range of cutting edge wireless techniques such as beam forming to initiate ubiqitous wireless connectivity with various data requirements up to multi-giga bits per second Digital Media Solution(DMS) Advanced Algorithm: engaged in research and development related to theories, algorithm, and application of image and video processing for Samsung Digital TVs Core Platform: Actively researching to provide Internet Protocol Television to provide internet and cable connectivity Future User Experience: develop user interface designs from conceptualization through prototyping to implementation Advanced Printing Solution Research in Software Architecture Technology enabling the efficient development of increasingly complex software Research areas in System Technology involves new features protoypes and etc Current and future research areas in Solution Software Technology are core research related to Web technologies and application of Web Services to printers Storage To develop quiet hard drives with highest storage capacity and lowest power consumption Organisation of RD Samsungs RD organisation run in SAIT consists of three layers: Samsungs technology competitiveness in core business areas identifies growth engines for the future and securing, and management of technology. The RD centres of each business focus on technology that is expected to deliver the long-term results. Division product development teams are responsible for marketing products due to hit markets in a short period of time. From the Figure 2, the organisation is shown to be a hybrid between centralised and decentralised RD. It is a simplified diagram of the organisation of Samsung RD involving SAIT and two of their centres in their global network of RD. Samsungs RD network consist of six centres in Korea and 18 centres in 9 different countries such as United States, United Kingdom, Russia, Israel, India, Japan and China. 11 These various RD centres and their distribution into research areas such as Dallas Telecom Laboratory that research on technologies and products for next-generation telecommunications systems. Innovation Strategy Firms Innovation Strategy Background and Strategy â€Å"By implementing this newly established RD plan, we can develop the technology that will drive Samsungs future.† -Hak-Soo Lee, vice-chairman of Samsung Electronics said.14 Samsung Electronics instituted many RD centres globally to enhance in-house product design. The first centre was established in Osaka, Japan, followed by another in Frankfurt, Germany to focus on products for the European markets.15 In the same year, Samsung Electronics established a research centre to address product planning needs in South-East Asian markets. In November 2000, Samsung Electronics targeted to transform itself into a â€Å"Digital -eCompany†, capable of leading in digital convergence. The company upgraded the development model from division-centric into portfolio-centri16. This aimed to multiple divisions and units to create integrated solutions for home networks, mobile networks, office networks and core-component business portfolios. With these initiatives, Samsung Electronics pursued four key areas: RD, design, brand marketing and corporate citizenship. Investment in Design and RD RD is an important innovation strategy at Samsung. RD and design centres developed technologies which is being used to produce products. Samsung Electronics employed more than 40000 engineers17 in its RD department, and 3,200 held PhDs. Samsung Electronics attributed its leading position in the industry to four main factors: creative people in the organization who could develop technologies; co-operation among business partners throughout the supply chain; the firms ability to explore and penetrate new markets; and the speed of innovation and product development18. Users-Centric Design Philosophy Samsung Electronics applied the design philosophy into its products and stressed that â€Å"design and creative strengths were at the heart of corporate competitiveness.†19 This reflected a concept of a balance between reason and feelings, from which Samsung Electronics developed a scale with â€Å"reason† on one end and â€Å"feeling† on the other to measure perfection of design. The products manufactured by Apple Computer Inc (â€Å"Apple†) occupied the â€Å"feeling† zone with an emphasis on simplicity of products, whereas Sony products tended toward the â€Å"reason† zone with lots of complex features.20 However, Samsung Electronics designers balanced â€Å"reason† and â€Å"feeling† by rationalizing the design of products using geometric and technological parameters and then enhancing the design such that products made an emotional connection with the user. Over 700 highly skilled designers in different design centres conducted various research projects in the fields of industrial design, graphic design, interaction design, human factors, lifestyle research; creative business-planning, visual brand strategy, materials exploration, colour theory and computer-aided design. Global Localization strategy Global Localization strategy is adopted, through which designers developed product design blueprints according to global design standards and themes, while remaining flexible enough to allow local design centres to accommodate specific market needs and cultural contexts.22 A simple example is explained by, Younghee Lee, vice-president of marketing, that beautiful design of mobile phones could be appreciated by a Parisian or Indian, but noted that the Indian user, who often lacked a reliable electricity supply, needed a longer-lasting battery than a Parisian.23 The Global Localization strategy helped Samsung Electronics establish itself as an innovative and first-class consumer electronics company. EXHIBIT 1: SAMSUNGS DESIGN PHILOSOPHY: BALANCE OF REASON AND FEELING Fast Follower To overcome the companys image as a producer of cheap products, Samsung Electronss product diversification differentiated the company from its key competitors, many of which were focused on single or smaller numbers of products. Apple, for example, specialised in portable music players and held a major share in the global market for these devices. Nokia and Motorola were best known for mobile phones, and Sony focused on consumer electronics. The market trends and technological, also the competitive circumstances impacts on its innovation strategy, which has a lots of reason to reveal that Samsung Electron is fast follower, although some brand-new design of products were launched. Protect its innovations Samsung Electronics strategy of combining product design, RD and brand management turned the firm into a leader in the consumer electronics market. Samsung Electronics operated six RD centres in South Korea and a total of 16 centres in eight different countries. These RD centres developed technologies that could be commercialised in the near future. The CTO developed proprietary technologies, managed the deployment of key technologies and guided the overall RD process within the organisation. This highly efficiency of organization system is not easily imitated by the rivals in a short period of time. Thus, it has enough evidence to believe that a large amount of RD spending combined with brand management as well as the effective organization system is able to protect its innovations. Patents and Achievement During seven years from 2001, Samsung Electronics received 19 awards at the International Design Excellence Awards (â€Å"IDEA†). In 2006, the company registered 17,377 patents worldwide, including patents aimed at fusion technology, nanotechnology and biotechnology24. In 2007, Samsung Electronics held a dominant worldwide market share25for LCDs and TVs. The company unparalleled edge and leadership in RD and design were underscored by awards for 32 of its products at the CES Innovations 2008 Awards. Challenges for the Future Competition in the consumer electronics market was fierce, as many global players entered the market with large product portfolios. Digital convergence invited more companies from related industries such as software, PC and network services to enter the market. Entry of such new players further intensified the competition. Competitors of Samsung Electronics such as LG, Nokia, Panasonic, Sony and some Chinese firms had started investing heavily in RD and product design. All major competitors adopted the concept of localizing their product design to suit target markets. The design advantage of Samsung Electronics started to diminish as product design strategies and processes became commoditized. Samsung Electronics had to devise strategies to defend not only its position in the market, but also its profitability in the competitive environment. Advancements in technology had shortened product lifecycles and product replacement had become a key driver for revenue growth. Samsung Electronics invested about 9% of net sales in RD of newer technologies, features and designs to offer newer products and attract customers. However, some of its competitors, including Apple, Sony and LG Electronics, had significantly lower RD expenditure per product. Firms such as Philips, Dell and Motorola were adopting outsourcing of product design to lower RD costs and shorten time-to-market. These brands were buying product blueprints and technology from contract manufacturers and independent design firms such as IDEO, Quanta Computer, Premier Imaging, HCL Technologies and Wipro Technologies. Companies took varying approaches to design outsourcing. For example, HP contributed key technology and design to its computers, whereas Dell preferred to adopt entire designs from its design partners. Motorola bought complete designs for its low-end mobile phones but kept tight control over the development of its high-end cell phones, such as the Razr. However, outsourcing of product design and RD raised serious concerns about intellectual property rights, product management, integrity and incubation of new competitors. For example, Motorola outsourced the design and manufacturing of its mobile phones to Taiwanese manufacturer BenQ. In 2004, BenQ started selling the mobile phones in the Chinese market under its own brand, which resulted in termination of its contract with Motorola. Considering the immediate urge to optimise RD costs and potential concerns associated with design outsourcing. References Samsung INC. (2009) [Online] Available from http://www.samsung.com/uk/aboutsamsung/corporateprofile/history03.html Samsung INC. (2009) [Online] Available from http://www.samsung.com/global/business/semiconductor/aboutus/ESH/ESH.html Samsung INC. (2009) [Online] Available from http://www.samsung.com/uk/aboutsamsung/corporateprofile/affiliatedcompanies.html Samsung INC. (2009) [Online] Available from http://www.samsung.com/uk/aboutsamsung/ourbusinesses/businessarea/devicesolutionsbusiness.html Gartner Newsroom: http://www.gartner.com/it/page.jsp?id=1126812 Nokia Connecting People: Story of Nokia http://www.nokia.com/about-nokia/company/story-of-nokia/mobile-revolution/leading-the-world Appsolutely Everything: Samsung Market Share: http://stats.getjar.com/statistics/world/manufacturer/Samsung Nokia: Mobile Revolution: http://www.nokia.com/about-nokia/company/story-of-nokia/mobile-revolution Nokia: Biz Covering: http://bizcovering.com/major-companies/nokias-revenue-lowered-with-twenty-seven-percent/ Samsung Research and Development: http://www.samsung.com/us/aboutsamsung/ourbusinesses/researchdevelopment.html Samsung RD Center(SISA): http://www.sisa.samsung.com/default.htm Kim, Y. (1997) â€Å"Technological Capabilities and Samsung Electronics International Production Network in Asia†, BRIE Kim, Y. (1997) â€Å"Technological Capabilities and Samsung Electronics International Production Network in Asia†, BRIE Working Paper 106, p. 20 Newswire (8 November 2005) â€Å"Samsung Companies Announce 5-Year, 47 Trillion Won Investment Plan† Kim, Y. (1997) â€Å"Technological Capabilities and Samsung Electronics International Production Network in Asia†, BRIE Working Paper 106, p. 26 Samsung Electronics (2001) â€Å"Annual Report† Samsung Electronics (2007) â€Å"Annual Report† Samsung Electronics (2007) â€Å"Annual Report† Samsung (2006) â€Å"Annual Report†, p. 41. Breen, B. (2007) â€Å"The Seoul of Design† Delaney, M., et al. (2002) â€Å"Global Localization†, Global Design and Cultural Identity Ibid., p. 44. Ewing, J. (2008) â€Å"Samsungs New Marketing Push†, BusinessWeek Samsung Electronics (2006) â€Å"Annual Report† Samsung Electronics (2007) â€Å"Annual Report†.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly